snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me5.8S-G74
sequence
CTTGCTCTGATGACAAAAACACGAAAAGAACAATCATGTTGAGACACTATGTGTCCTGC
AGTGCTGAGCTT
  Box motif
  Complementary to target RNA
length 71
organism Drosophila_melanogaster
snoRNA name snoRNA:Me5.8S-G74
alias
chromosome ⁄ contig 3L
locus ⁄ host gene CG13900
organization Intronic
target RNA 5.8S rRNA
modification type C/D
modification site 5.8S:G74
accession no NR_003844,AE014296
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved