snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me28S-C788b
sequence
AGCTCTATGATGTTATTTTACATATGTTAGACTAATGAAATGATTTGATTGTAATTTAG
TAACTGAGCTT
  Box motif
  Complementary to target RNA
length 70
organism Drosophila_melanogaster
snoRNA name snoRNA:Me28S-C788b
alias
chromosome ⁄ contig 3L
locus ⁄ host gene CG13900
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C788
accession no NR_003840,AE014296
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved