snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me28S-C2645a
sequence
ACAACCATGATGAAATCGTTAGATGGGGACAACTGATTACTGTGACTGATTCATCTCGA
TAGTAGATCTGATTTT
  Box motif
  Complementary to target RNA
length 75
organism Drosophila_melanogaster
snoRNA name snoRNA:Me28S-C2645a
alias
chromosome ⁄ contig 2L
locus ⁄ host gene pncr012:2L
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C2645
accession no NR_003781,AE014134
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved