snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:28S-A2113
sequence
CCCATAATGATGATCCTATTGATTCCGAATGCCTTGACGAATCCTTTTTATACTAGAGA
CTCTTTCTGACGCT
  Box motif
  Complementary to target RNA
length 73
organism Drosophila_melanogaster
snoRNA name snoRNA:28S-A2113
alias
chromosome ⁄ contig 2L
locus ⁄ host gene RpL30
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A2113
accession no NR_003762,AE014134
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved