snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me18S-A934
sequence
ACAAAAATGATGACTAGACATTTACCTCTTGAGCCTAATTTGCATGCCGACAACGACTG
TGAGAGCAAGCCCCCAAAACTTACCTGAGCCG
  Box motif
  Complementary to target RNA
length 91
organism Drosophila_melanogaster
snoRNA name snoRNA:Me18S-A934
alias
chromosome ⁄ contig 2L
locus ⁄ host gene crol
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A934
accession no NR_003759,AE014134
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved