snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me18S-G642
sequence
CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATT
CAAGTTCAATTCTGAAAGC
  Box motif
  Complementary to target RNA
length 78
organism Drosophila_melanogaster
snoRNA name snoRNA:Me18S-G642
alias
chromosome ⁄ contig 2L
locus ⁄ host gene ab
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G642
accession no NR_003758,AE014134
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved