snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me18S-A1576
sequence
CTCAAATGATGAAACAGATGACGAGACTGAAGGAACAAATTCTCGACTTGGCGCTGTAT
TTTTCAGTGCCTCGTTATATATTTGTTCATTTAAGATGATTCGGCGATCTGATG
  Box motif
  Complementary to target RNA
length 113
organism Drosophila_melanogaster
snoRNA name snoRNA:Me18S-A1576
alias
chromosome ⁄ contig 2L
locus ⁄ host gene Uhg2
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A1576
accession no NR_001641,AE014134
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved