snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me28S-G2743
sequence
TCGCCCATGATGAAGGGCGTTTCCTGGGCCTTGTCCAGCCTTTCGTAGGCGGCATAGAA
CTCCTTGCACTGCTGATTGA
  Box motif
  Complementary to target RNA
length 79
organism Drosophila_melanogaster
snoRNA name snoRNA:Me28S-G2743
alias
chromosome ⁄ contig 2L
locus ⁄ host gene CG11221
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G2743
accession no NR_003757,AE014134
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved