snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me28S-C437
sequence
TATCATTTGATGAATTAAATTCCATAACGGATACCTGTCTTATTAAAACACAATAGGGA
AAGAAACTCCGCCATGGAAACATATATAACCCATAGCGTTCAGCGACAACTGAACAA
  Box motif
  Complementary to target RNA
length 116
organism Drosophila_melanogaster
snoRNA name snoRNA:Me28S-C437
alias
chromosome ⁄ contig 2L
locus ⁄ host gene ed
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:C437
accession no NR_003753,AE014134
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved