snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:U3:9B
sequence
CTTTCACACTAGCTGAAAGCCAAGTGCACCCGCGTTGATGAGTTGAATCGTTCTGTCCG
GCAGCGTGAGGATTTGCCCAGCACCCTTGTGGGATGCACTGCATCCTTAGCGGGGAGCGG
GGCTTCGATGATCGCTCGGTTTGAACGGATAGAGCGAATTCTGAGTGGT
  Box motif
  Complementary to target RNA
length 168
organism Drosophila_melanogaster
snoRNA name snoRNA:U3:9B
alias
chromosome ⁄ contig X
locus ⁄ host gene Mono:3:snoRNA:U3:9B
organization Mono
target RNA 18S rRNA
modification type C/D
modification site Unknown
accession no NR_002465,AE014298
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved