snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me28S-G3255a
sequence
AGTTATCTGATGATTTATAATTCTATTTTCTGACATCTCTTATGAACCGTTGTGATTCA
AATCAGTTATAACTAATTCTGACACA
  Box motif
  Complementary to target RNA
length 85
organism Drosophila_melanogaster
snoRNA name snoRNA:Me28S-G3255a
alias
chromosome ⁄ contig 2R
locus ⁄ host gene Poly:2:snoRNA:Psi28S-2949
organization Poly
target RNA 28S rRNA
modification type C/D
modification site 28S:G3255
accession no NR_003787,AE013599
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved