snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Or-aca4
sequence
TTTCCTTCTGCACTGTGGCAAGAGTAGCTACTGTATCCAGCGTAGCTCGCTCTAATCCG
CTGAAGGTAGATCAAATCGTTCATCCTCCATTGCCGTTGACACTGCACTAGTGTTCCATA
TATCTAAGTGGGCATTGCAGTTCGTATGTGGGTGAATACACTT
  Box motif
  Complementary to target RNA
length 162
organism Drosophila_melanogaster
snoRNA name snoRNA:Or-aca4
alias
chromosome ⁄ contig 2R
locus ⁄ host gene Mono:7:snoRNA:Or-aca4
organization Mono
target RNA
modification type unknown
modification site
accession no NR_003805,AE013599
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved