snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Psi28S-3342
sequence
ATTCCCCTTCATTTTCCGCCACGCGTTGTTGTCCAAAATAATATGACAAATCATACGTG
CCCATGTTCAAGGGGAACATTAAACAAAATTCTCTGATAAATAGGAAACTGATAAAAGTC
GATTGAATTAATTCTAGACATCAGTGCCAAGGACGAGAAACAATT
  Box motif
  Complementary to target RNA
length 164
organism Drosophila_melanogaster
snoRNA name snoRNA:Psi28S-3342
alias
chromosome ⁄ contig X
locus ⁄ host gene Mono:2:snoRNA:Psi28S-3342
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3342
accession no NR_002461,AE014298
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved