snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me18S-U1356c
sequence
GCCTTCTTGATGACAACTTCATACCCAACTCAGAAAAACTATGTTGAAATCTTTTTAAC
ATGCATCACCATCTGATTAA
  Box motif
  Complementary to target RNA
length 79
organism Drosophila_melanogaster
snoRNA name snoRNA:Me18S-U1356c
alias
chromosome ⁄ contig 3L
locus ⁄ host gene Poly:1:snoRNA:Or-CD11
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:T1356
accession no NR_003876,AE014296
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved