snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:U3:54Aa
sequence
TTCACATACTTTCACACTAGCTGAAAGCCAAGTGCACCCGCGTTGATGAGTTGAATCGT
TCTATTCGGCAGCGTGAGGATTTGCCCAGTGTTCTTTGTGGTGCCTCGCATCGTTCGGGA
CGCAGGGCTTCGATGATCGCTCGGTAGAAACGGATAGAGCGAATTCTGAGTGGT
  Box motif
  Complementary to target RNA
length 173
organism Drosophila_melanogaster
snoRNA name snoRNA:U3:54Aa
alias
chromosome ⁄ contig 2R
locus ⁄ host gene Mono:5:snoRNA:U3:54Aa
organization Mono
target RNA 18S rRNA
modification type C/D
modification site Unknown
accession no NR_002544,AE013599
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved