snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me18S-A1806
sequence
GATGATATGATGAAAACTTTACTACCCGAACCATCGTGTGGGCCTTTGCCTCTGGTAAA
GGGACGTAATTCTGATTCA
  Box motif
  Complementary to target RNA
length 78
organism Drosophila_melanogaster
snoRNA name snoRNA:Me18S-A1806
alias
chromosome ⁄ contig 3L
locus ⁄ host gene Mono:1:snoRNA:Me18S-A1806
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:A1806
accession no NR_003861,AE014296
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved