snOPY snoRNA Orthological Gene Database
Drosophila_melanogaster snoRNA:Me28S-A992
sequence
GTTTATATGATGTTACTTCTAGTATAGTTCATTAGAAACACACATGTTACAAACTTTTC
GAAGCTGATATA
  Box motif
  Complementary to target RNA
length 71
organism Drosophila_melanogaster
snoRNA name snoRNA:Me28S-A992
alias
chromosome ⁄ contig 2R
locus ⁄ host gene Poly:3:snoRNA:Me18S-C1366
organization Poly
target RNA 28S rRNA
modification type C/D
modification site 28S:A992
accession no NR_003800,AE013599
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved