snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA9
sequence
TTGCAAGCCTTCGAGATGCTTGAGTCTGGGGTGACTGGGTGCATTCCTGCATTGCTTGC
CAGAGTGTTCTGAAATGGTTTGAGGCCTTGCCCTGTCTCTTCCTCAGAACATAGCCATAG
GCATTTCACAGTTTT
  Box motif
  Complementary to target RNA
length 134
organism Dasypus_novemcinctus
snoRNA name SNORA9
alias
chromosome ⁄ contig GeneScaffold_238
locus ⁄ host gene ZCCHC8
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved