snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA28
sequence
AAGCAATGCTCTGTGCAGATGATTAAAACCATCTGGCACAATTTCTGCTTGCTATAACA
AGAAAGTCTGACCTATTCTGGTGTTCTCTCTTTGACGAGACAAGCCCCATTATATAGACT
ACACCAGC
  Box motif
  Complementary to target RNA
length 127
organism Dasypus_novemcinctus
snoRNA name SNORA28
alias
chromosome ⁄ contig GeneScaffold_3802
locus ⁄ host gene C15orf42
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved