snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORD61
sequence
GCTGTGATGAGTTTGATTGCATTGATCATCGGAGATGATTTTTGTCCTCTAAGAAGTCC
TGAGCTT
  Box motif
  Complementary to target RNA
length 66
organism Dasypus_novemcinctus
snoRNA name SNORD61
alias
chromosome ⁄ contig GeneScaffold_4268
locus ⁄ host gene ENSDNOG00000017199
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved