snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORD94
sequence
CAGGCTGTGATGATTGGCGCAGGGGTACGGACCTCAGCTGAGTCATGGGAGCTGAGTGT
ACGTGCGTCCCCCTCGTCCTGCACGTGGCAGGTCGGTGGTGAGCACTGACACGAGACAAC
GCCTCAATCTGAGCCTG
  Box motif
  Complementary to target RNA
length 136
organism Dasypus_novemcinctus
snoRNA name SNORD94
alias
chromosome ⁄ contig GeneScaffold_3088
locus ⁄ host gene PTCD3
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved