snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORD56
sequence
CTACAATGATGGCAATATTTTTCGTCAACAGCAGTTCACCTATTGCGTGAGTGTTGATT
AGTTTGGGTCTGAGTGA
  Box motif
  Complementary to target RNA
length 76
organism Dasypus_novemcinctus
snoRNA name SNORD56
alias
chromosome ⁄ contig GeneScaffold_1303
locus ⁄ host gene NOL5A
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved