snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORD73
sequence
AATACATGATGAGAAAATGTTTCGGTCCCAGCTGATGTACACTGATAACTTAACATTTT
TCTGATGTT
  Box motif
  Complementary to target RNA
length 68
organism Dasypus_novemcinctus
snoRNA name SNORD73
alias
chromosome ⁄ contig GeneScaffold_4129
locus ⁄ host gene ENSDNOG00000003380
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved