snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA65
sequence
CCCGCCACTGCACCTGACCAGTTCTCTGTTGGCTGGTGCAATCCAGTGGTGAGCTGATA
TTAAACCCCAGCTTAGGAAACAGGGTTGTTCTTCATATGGATGACTCTGTGCCGAAAGCA
TGGGAACAGCC
  Box motif
  Complementary to target RNA
length 130
organism Dasypus_novemcinctus
snoRNA name SNORA65
alias
chromosome ⁄ contig GeneScaffold_3286
locus ⁄ host gene ENSDNOG00000008412
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved