snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA63
sequence
TTACATATTATATATTCTTTTAAAAGAATTTTGTCCCCCTGCTAAAAATAAAGTTGTTT
CTTATTTATGCCTGCCTGCTGAACTCTTGTAGCAACCAAGGACACTTGGTTTCATACAC
  Box motif
  Complementary to target RNA
length 118
organism Dasypus_novemcinctus
snoRNA name SNORA63
alias
chromosome ⁄ contig GeneScaffold_579
locus ⁄ host gene SLC44A1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved