snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORD47
sequence
AACCAGTGATGTAATGATTCTGCCAAATGAAGTAGAATGATATCACTCAAAACCGTTCC
ATATTGTTTCTGAGGTT
  Box motif
  Complementary to target RNA
length 76
organism Dasypus_novemcinctus
snoRNA name SNORD47
alias
chromosome ⁄ contig scaffold_96896
locus ⁄ host gene Poly:9:SNORD47
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved