snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORD65
sequence
AAATGATGAGATCACCAAAAATAGCTGGAATTACCGGCAGATGGTGTAGTGGTGAGCAT
GGTTTTCTGAAG
  Box motif
  Complementary to target RNA
length 71
organism Dasypus_novemcinctus
snoRNA name SNORD65
alias
chromosome ⁄ contig scaffold_153123
locus ⁄ host gene Poly:11:SNORD49
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved