snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORD12
sequence
GCTGGCTTATATGATGACTGGACATTTTTCCCCAACAGATCCACCATGTTGATCTAAAT
TCTCTAAGCCAGTTTCTGGCTGATATGCCAGC
  Box motif
  Complementary to target RNA
length 91
organism Dasypus_novemcinctus
snoRNA name SNORD12
alias
chromosome ⁄ contig scaffold_270030
locus ⁄ host gene Poly:15:SNORD12
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved