snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA40
sequence
GGCACTTGAGTTTGTTTTTGTCTGATTTGTAGACAAAGACCAGATAGACAGGTGCAAAG
AATAAGTCCTCTTTCGCAACCCAGAACTCATTGTTCAGTATGAGTTTTGATACAGATAAG
AAGGGACATA
  Box motif
  Complementary to target RNA
length 129
organism Dasypus_novemcinctus
snoRNA name SNORA40
alias
chromosome ⁄ contig GeneScaffold_5567
locus ⁄ host gene Poly:16:SNORA32
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved