snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA36
sequence
TTCCAAAGTGTTGAGTTCAGTTCAGGGTAGTTTCTCTGTTCTGTTAATTAAACTTTGGA
AAATTGAAATGGGCTAGGATAATTGGTTGGATAGAAAAGTACTGTTCTATTCACTCATAT
CCCAGCCTACAAAA
  Box motif
  Complementary to target RNA
length 133
organism Dasypus_novemcinctus
snoRNA name SNORA36
alias
chromosome ⁄ contig scaffold_92352
locus ⁄ host gene Mono:202:SNORA36
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved