snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA18
sequence
GCTGAGGTCTATTCCAATGGGCTCTCTCTGTAGACCCACATTCTTGGAAATGCCTCACA
GAGGAATGTGGCAGCTCAGCTTTACTCACAGAACTGCTTGTTAGATTTGTGAGAAGGAAC
TATAAGATCATT
  Box motif
  Complementary to target RNA
length 131
organism Dasypus_novemcinctus
snoRNA name SNORA18
alias
chromosome ⁄ contig scaffold_77425
locus ⁄ host gene Mono:181:SNORA18
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved