snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA32
sequence
TGGTCATTACTAAGGCTTTTAGAATGCAGTTTCTGATTTGCTGTGGAGTTGACCATAAA
AAAAAAACTCCCCACCGTGCTTTCTTTTTGCTACCTTGCTAGCATTCAGCCTATTGGGAA
CATTC
  Box motif
  Complementary to target RNA
length 124
organism Dasypus_novemcinctus
snoRNA name SNORA32
alias
chromosome ⁄ contig scaffold_53368
locus ⁄ host gene Mono:139:SNORA32
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved