snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA38
sequence
CCCTACTACAAAGGTGTGTCTGTGGTTTCCTGTCCCTGGACACTTAAGAATTGGAGGCA
AAGAGAGGTGGACTTGGATGTCTGGAGCCAGCTTGCTCTCCGCAGGCTCAAGATCACCCT
TTGACACAC
  Box motif
  Complementary to target RNA
length 128
organism Dasypus_novemcinctus
snoRNA name SNORA38
alias
chromosome ⁄ contig scaffold_51803
locus ⁄ host gene Mono:134:SNORA38
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved