snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA77
sequence
GCAGACTCACTCTGCATCCAACTGCAGCCCCAGTCTGGGTGCTTTTTTCGTCTGCCAGA
GAAACACCTGGCCGCCATGTGGGCCTCGACTTGTCGATGGCACTGCAGCTGGCCGGGGAC
AGTGGT
  Box motif
  Complementary to target RNA
length 125
organism Dasypus_novemcinctus
snoRNA name SNORA77
alias
chromosome ⁄ contig scaffold_43302
locus ⁄ host gene Mono:118:SNORA77
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved