snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORD115
sequence
GTGTCTATGAGAATTTAACTTGTTGGAGACAGGTGATTACATAAAAGTCATGCTCTACA
GAATTATGCAGAGAGGC
  Box motif
  Complementary to target RNA
length 76
organism Dasypus_novemcinctus
snoRNA name SNORD115
alias
chromosome ⁄ contig scaffold_24931
locus ⁄ host gene Poly:3:SNORD115
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved