snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA12
sequence
GACCATAGCTGAATGGCAGATTCATTAAGTTTTCAAATTTGCCCGATTCTGCCACATAT
AATATATAGCAGCTGGCAAAGGCTTGATGACAAAGAGGTTTCTTGCAAGACTTTCCTGCA
CCAGAGTTTGGCTCCCCCATGT
  Box motif
  Complementary to target RNA
length 141
organism Dasypus_novemcinctus
snoRNA name SNORA12
alias
chromosome ⁄ contig scaffold_250015
locus ⁄ host gene Mono:330:SNORA12
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved