snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA41
sequence
CTCCACAGCTACTGGTCTGCAGCTGTTCTTATGGTGGCAATTGTGGCATTCCTCTGTGG
TAAAGAATCTGTTACATAATTAAATACTTCTTTCTTAGCAAAACAGAAAGTGGGCATGTG
TGTGACAAAGTTAA
  Box motif
  Complementary to target RNA
length 133
organism Dasypus_novemcinctus
snoRNA name SNORA41
alias
chromosome ⁄ contig GeneScaffold_373
locus ⁄ host gene Mono:373:SNORA41
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved