snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA73
sequence
CCAGTGTGGAGACCCCAGGAGGTCACCCTCCCTGGGCTCTGTCCAGGTGGTGCAAGGGA
GCATAACGCTTTGCCCAGGGAGGTACAGTCCCTTTCCCAACATTGGAGATGAAGCTGGCC
TCAAGCATATGCCTGCATAGTCCTGCAGCTTCTCAGAATCCTATGGAAAATGACTGAGAA
GACAAACCATACAGGAAGCAACT
  Box motif
  Complementary to target RNA
length 202
organism Dasypus_novemcinctus
snoRNA name SNORA73
alias
chromosome ⁄ contig scaffold_101985
locus ⁄ host gene Mono:213:SNORA73
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved