snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORD113
sequence
TAGATGGATGAGGACCACTGTGGCGTATGAGTGATGGATGATGAATACATGTCTGGATG
GCTCTGGAGTTCAG
  Box motif
  Complementary to target RNA
length 73
organism Dasypus_novemcinctus
snoRNA name SNORD113
alias
chromosome ⁄ contig scaffold_4493
locus ⁄ host gene Mono:1:SNORD113
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved