snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORD31
sequence
CTCACCAGTGATGAGTTGAATACCGCCCCAGTCTGAAAACTATGACTGAAAGGTATTTC
TGAGCTGTG
  Box motif
  Complementary to target RNA
length 68
organism Dasypus_novemcinctus
snoRNA name SNORD31
alias
chromosome ⁄ contig GeneScaffold_5745
locus ⁄ host gene Poly:21:SNORD22
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved