snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA1
sequence
TTTTAAAAAATATGTGAGAATGGGCACAGTTGATCGTGGTGTCCAGAATTGATAAATGT
GGCTAAATTGAGACACAGATTATGCTTCCACCAGAGTAAATTCATTGCAGTAGTGACAAT
GAGAACTGTAATTTTT
  Box motif
  Complementary to target RNA
length 135
organism Dasypus_novemcinctus
snoRNA name SNORA1
alias
chromosome ⁄ contig GeneScaffold_7112
locus ⁄ host gene Mono:432:SNORA1
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved