snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORD30
sequence
ATTACCAAAGAAGTTTATAGAATCTCATTCTTCTGACTAATTAGAGACATACCATCTAT
CTATA
  Box motif
  Complementary to target RNA
length 64
organism Dasypus_novemcinctus
snoRNA name SNORD30
alias
chromosome ⁄ contig scaffold_184330
locus ⁄ host gene Mono:291:SNORD30
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved