snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORA51
sequence
TGCCTCCTGGTACTTACCACAGGCTGTGTTCTTGCACTGACTGTATACAAAAAGGAGGC
AGAATGAGCCTACCCCATATACACCTTAGCCCAGGCTTTGTACCTGGCCTGAATTGCGAG
TGGGGGACATGG
  Box motif
  Complementary to target RNA
length 131
organism Dasypus_novemcinctus
snoRNA name SNORA51
alias
chromosome ⁄ contig scaffold_161738
locus ⁄ host gene Mono:280:SNORA51
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved