snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORD77
sequence
ACATAGTGATGGTTGCATAGTTCAGCAGATTGAGTTGTGAAGATATGTTATTTGTCTGA
TGTGTCT
  Box motif
  Complementary to target RNA
length 66
organism Dasypus_novemcinctus
snoRNA name SNORD77
alias
chromosome ⁄ contig GeneScaffold_2356
locus ⁄ host gene Poly:22:SNORD81
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved