snOPY snoRNA Orthological Gene Database
Dasypus_novemcinctus SNORD102
sequence
AGTTTGATGATGATTGTCTTTTTGATTGCTTTAAAGCAATGTGAAAAACACATTTCACC
GGCTCTGAAAGCT
  Box motif
  Complementary to target RNA
length 72
organism Dasypus_novemcinctus
snoRNA name SNORD102
alias
chromosome ⁄ contig scaffold_86754
locus ⁄ host gene Mono:194:SNORD102
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved