snOPY snoRNA Orthological Gene Database
Danio_rerio SNORD94
sequence
AGGGCAGTGCTGATTGGCGCAGGGGTGACGGAGCACAGATGCATGCTGGGAAGTGTGGT
TTTCTGCAGAACTCTACTGTTCTACCTCGTCCT
  Box motif
  Complementary to target RNA
length 92
organism Danio_rerio
snoRNA name SNORD94
alias
chromosome ⁄ contig 24.0
locus ⁄ host gene Mono:20:SNORD94
organization Mono
target RNA U6 snRNA
modification type C/D
modification site
accession no NC_007135.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved