snOPY snoRNA Orthological Gene Database
Danio_rerio SNORD101
sequence
GCTATGATGAATTTTCAATCTTTAGTCGGATACCCCTTCACTCTTAATTATGAGTGAGA
GATCCAGTCTGAGAAGC
  Box motif
  Complementary to target RNA
length 76
organism Danio_rerio
snoRNA name SNORD101
alias
chromosome ⁄ contig 23
locus ⁄ host gene rps12
organization Intronic
target RNA Unknown
modification type C/D
modification site
accession no NC_007134.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved