snOPY snoRNA Orthological Gene Database
Danio_rerio SNORA79
sequence
TGATGATCGTTCCTCCTGCCGCTCAGAGATCATGCGGCTCAGGATTTTAGATCATCATA
GAGAAATCTGAGTCTGTTTCACCCGGTGTGTGCCGACCGACGGTCTCCTGTGGCCACGCT
GGACTTTGCGGGACTCTACAGCT
  Box motif
  Complementary to target RNA
length 142
organism Danio_rerio
snoRNA name SNORA79
alias
chromosome ⁄ contig 19
locus ⁄ host gene kpnb1
organization Intronic
target RNA U6 snRNA
modification type H/ACA
modification site
accession no NC_007130.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved