snOPY snoRNA Orthological Gene Database
Danio_rerio snoU2_19
sequence
GGTCAATGATGAGAACTAGCCAAATCTGAGTGTGTGTGTCACACCACTGATTATTTGCG
AGA
  Box motif
  Complementary to target RNA
length 62
organism Danio_rerio
snoRNA name snoU2_19
alias
chromosome ⁄ contig 15.0
locus ⁄ host gene Mono:SCARNA9
organization Mono
target RNA U2 snRNA
modification type C/D
modification site
accession no NC_007126.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved