snOPY snoRNA Orthological Gene Database
Danio_rerio SNORD61
sequence
GCTGTGATGTTTTTTTTTGTGGCAGTGATCTACTTGAGCTGATCTAGTCCACAATTTCC
TCTAAGAAGTTCTGAGCTT
  Box motif
  Complementary to target RNA
length 78
organism Danio_rerio
snoRNA name SNORD61
alias
chromosome ⁄ contig 14.0
locus ⁄ host gene rbmx
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site
accession no NC_007125.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved